General examples showing how we have used Mu killer can be found under the data link.
In order to silence Mu activity, your Mu active plants should be crossed to the Mu killer homozygous stock. Mu killer is equally efficient at silencing active Mutator elements when used as male or female. All of the progeny of this cross will be inactivated for Mutator activity.
The inactive F1 plants that are heterozygous for your mutant allele should be self-fertilized to confirm penetrence of the mutant phenotype in this hybrid background, as well as out-crossed to the appropriate inbred lines (see below). Since Muk stocks are also homozygous for the a1-mum2 reporter, the self-fertilization will result in kernels that are homozygous for the a1-mum2 Mutator reporter; pale colorless kernels with a lack of excisions in these families will indicate that Mu activity has been lost.
To confirm the loss of activity, plants can also be subjected to molecular analysis. To do this, digest DNA from an upper leaf (loss of activity is progressive in F1 plants) with HinfI and probe the blot with an internal Mu1 probe. HinfI is a methyl-sensitive restriction enzyme that cuts in the terminal inverted repeats of Mu1 elements. A loss of activity will be associated with the loss of the 1.4 kb Mu1 and 1.7 kb Mu1.7 internal fragments and the appearance of a number of new, larger fragments. For an example of a HinfI digested Southern blot probed with the internal region of Mu1, please see the Data link.
Mu killer silences Mutator activity heritably, so silenced plants can be out-crossed to lines that lack Mutator activity and that have few Mu elements (most standard inbred lines) and the lines will not reactivate. Thus, Mu element copy number can be reduced by half every generation, making identification of cosegregating Mu element insertions relatively simple.
Mu Suppression:
Mu Suppression occurs when the phenotype of a mutant allele is dependent on the status of Mutator activity. For example, a mutant allele may only show a phenotype when the plant has an active Mutator system.
To test for Mu Suppression, the same plant that was crossed to homozygous Muk should also be crossed to the Mutator permissive a1-mum2 reporter line. If the phenotype is present in the a1-mum2 test-cross families and missing in the Muk inactivated families, it is likely that the mutation is suppressible. This is good; in that you know that your mutant is almost certainly tagged with a Mu element, but bad in that silencing activity results in losing your mutant phenotype.
Genotyping for Mu killer
The easiest way to genotype for Mu killer is by PCR. Use the following conditions:
MuDR Primer: AGGAGAGACGGTGACAAGAGGAGTA
Flanking primer: CCTTTGGTCAGTTCGGTTATCTCTG
1. Denature 94C for 4min.
2. 94C for 38sec
3. 59.5C for 45sec
4. 72C for 1min
5. Goto step 2 x 34 times
6. 72C 5 min.
Product = 825bp
Please send Questions or Comments on Mu killer or this web site to
